Please enable JavaScript.

Coggle requires JavaScript to display documents.

The Metarhizium anisopliae Perilipin Homolog MPL1 Regulates Lipid…

- - - - Cope with different tasks as the absence of MPL1 produced unique phenotypes
        
        Reduced appressorial turgor pressure
        and decreased virulence against an insect host
  - - - Target and anchor Per A to LDs and are critical for
        TAG storage
  - - - MPL1 has multiple phosphorylation sites
  - - - Yeast cells expressing Mpl1 were unable to make use of their stored lipids during starvation.
        
        Lose the phosphorylation mechanism for removing perilipin-like proteins to access LDs
  - - - Take up water to generate turgor for mechanical penetration of the host surface
        
        Turgor is generated by accumulation of solutes,
        particularly the lipid-breakdown product glycerol
- - - - total of LDs diminishes by 62% indicative of lipid degradation during germination
      - the remaining will migrate to the germ tube apexes
    - - This indicating that t knock-out of Mpl1 impairs
      - not abolish, the ability of M. anisopliae to store lipid
    - - 50% of the mutant Mpl1 germ tube lack of LDs
    - - This lead to the enrichment in wild type appressoria
      - The appressoria of MPl1 mutant do not have LDs
    - - LDs dispersed throughout the hyphal body cells in wild type
      - while the LDs is fewer in Mpl1 mutants
        
        The LDs 2-fold more lipid in WT conidia relative to Mpl1 mutant conidia
        
        the more difference in lipid can be seen in WT during germination whic is level >7-fold
    - - thos to ensure the extended survival when food is depleting
    - - there is o significance difference in lipid contents
  - - - This formed between the appressorium and conidial mother cells
    - - There is significant reduction of mortality and speed of kill in mutant strain
      - the mutant failed to achive 50% mortality before the insects pupated
      - This indicate that lack of mutant strain affects fungal virulence by reducing the mechanical penetration of the host cuticle
- - - - (where lipid targeting functions reside)
    - - 3 hydrophobic regions (H1, H2, H3)
      - β-strands
      - N-terminal
      - acidic region
    - - BUT it has similar overall structure & some conserved regions with N-terminal sequence
  - - - Following the addition of oleic acid to minimal medium
    - - Lipid accumulation
      - Increases intracellular levels of perilipin
    - - As lipid stores used for mobilization during germ tube elongation
    - - Expressed MPL1-GFP fusion protein in M. anisopliae using Aspergillus GpdA promoter
      - Determined whether LD localization is a general quality of MPL1
        
        by expressing it with the Gal1-inducible promoter in the yeast S. cerevisiae
- - - - 3. RT-PCR Analysis of Gene Expression
        
        4. Fluorescence Microscopy
        
        5. Lipid Quantification
        
        6. Appressorial Turgor Assay
        
        7. Insect Bioassay
        
        Virulence of the wild type and Mpl1 was
        assayed against newly emerged 5th instar larvae of M. sexta
        
        Conidia were applied
        
        2 more items...
        
        Mortality was recorded every 12 h.
        
        appressoria were induced
        on locust hind wings
        
        assayed using serial solutions of PEG-8000
        
        Individual wings were dipped in PEG solutions
        for 10 min
        
        percentage of collapsed appressoria
        was determined from 300 cells per PEG solution
        
        phosphoric acid-vanillin method
        
        Spore suspensions were added to glass tubes
        
        2 ml of 18 M H2SO4 was added
        
        tubes were boiled
        in a water bath for 10 min.
        
        5 ml of phosphoric acid-vanillin reagent added
        
        tubes were incubated at 37 °C
        for 15 min
        
        centrifuged, and the absorbance
        of supernatants was measured at 530 nm
        
        yeast studies
        
        incubated for up to 20 h to induce starvation
        
        cell concentration was adjusted to A600 2.0 and
        0.5 ml used for lipid assay
        
        washed three times, adjusted toA6001.0
        with sterile water
        
        Duncan’s analysis of variance
        analysis
        
        single colony of pYes2Per transformed
        yeast cells was incubated overnight
        
        YPD plus 600 M OA
        
        2% raffinose SC-U
        
        YPD
        
        2% raffinose SC-U plus OA
        
        fixed in 3% formaldehyde in PBS for 20 min
        
        stained with either or Bodipy
        
        monitor gene expression of Mpl1 mycelium from 36-h Sabouraud dextrose
        
        collected by filtration
        
        wash three times with sterile distilled water
        
        incubated
        
        10 ml of water
        
        water supplemented with 0.1% bean root exudate
        
        1% cuticle
        
        minimal medium
        
        glucose 10 g/liter
        
        NaNO3 6 g/liter
        
        KCl 0.52 g/liter
        
        MgSO47H2O 0.52 g/liter
        
        KH2PO4 0.25 g/liter
        
        hemolymph
        of Manduca sexta
        
        identify any inductive relationship
        with fatty acids
        
        oleic acid (OA, 600 M) was added to
        36-hMMcultures and incubated for 1–12 h.
        
        mycelia were
        collected
        
        cDNA conversion
        
        RT-PCR
        analysis
        
        RNA extraction
      - Primers
        
        PerEF (CTTGGATCCCGGGATGGCTGTCCCTCAGGTCAA)
        
        PerER (CTTGGATCCTTGGCATTGGCATAGACT)
      - digested with BamHI
        
        inserted BamHI site of pYes2 (Invitrogen) to generate pYes2Per.
      - GFP gene
        
        GfpPerF (CCGAGCTCGGATCCCGTACCGGTCGCCACCATG)
        
        GfpPerR (AGGGACAGCCATCCCCTTGTACAGCTCGTCCATGC)
        
        deleting the 3 TAA stop codon
      - integrated into the SmaI site of plasmid pYes2Per using an in-fusion dry-down PCR cloning kit
        
        plasmid pGfpPer
      - Gfp-Mpl1 fusion product excised from pGfpPer
      - inserted into the BamHI site of pBARGPE1 under the control of a constitutive Aspergillus GpdA promoter
      - linearized with ScaI
      - transformed into M. anisopliae protoplasts
    - - full cDNA sequence was cloned
      - genomic DNA with
        flanking sequences was obtained by primer walking
      - Gene deletion was conducted
        using the plasmid pGPS3Bar
- - - - they have additional roles in maintaining membranes and moving components around cells
  - - - such as perilipin, adipocyte differentiation-related protein, and TIP47
      - have a characteristic series of hydrophobic
        
        sequences (the PAT domain) that facilitate their localization to
        
        the surface of lipid droplets.