Genetic variation of Dayak fruit bats (Dyacopterus spadiceus) between regions of western and eastern Sarawak by using Cytochrome B
REFERENCES
EXPECTED OUTCOMES
INTRODUCTION
WORK SCHEDULE
SUMMARY
MATERIALS AND METHODS
LITERATURE REVIEW
click to edit
A) Sample collection
B) Polymerase Chain Reaction (PCR) Amplification and Purification
C) Sequence Alignment and Phylogenetic Analysis
-The smallest species of Dyacopterus.
In this research, we want to determine the genetic variation of Dayak fruit bats between regions of western and eastern Sarawak using Cytochrome B for molecular analysis. Cytochrome B is an electron-carrying mitochondrial protein, only component of complex III that is formed from mitochondrial DNA, and it plays a vital role in oxidative phosphorylation in which oxygen and simple sugars are used to form adenosine triphosphate (ATP) for energy (U.S. National Library of Medicine, April 2014).
click to edit
U.S. National Library of Medicine. (April, 2014). Mt-CyB gene (mitochondrially encoded cytochrome b). Retrieved from https://ghr.nlm.nih.gov/gene/MT-CYB
Csorba, G., Bumrungsri, S., Francis, C., Bates, P., Gumal, M., & Kingston, T. (2008). Dycopterus spadiceus. Retrieved from http://dx.doi.org/10.2305/IUCN.UK.2008.RLTS.T6931A12816785.en
Kristofer, M. H., Dieter, K., Rai Kristie Salve, C. G., Nina, R. I., & Martua, H. S. (2007). Taxonomy and natural history of the southeast Asian fruit-bat genus Dyacopterus. Journal of Mammalogy, 88 (2), 302-318.
Objective
Problem Statement
Hypothesis
H0: There is no genetic variation of Dayak fruit bats between regions of western and eastern Sarawak.
H1: There is genetic variation of Dayak fruit bats between regions of western and eastern Sarawak.
- To study the genetic variation of Dayak fruit bats in Sarawak.
- To compare the genetic variation of Dayak fruit bats between regions of western and eastern Sarawak.
- To provide data analysis for conservation purposes.
- Lack of research study of Dayak fruit bats (NT).
- Rare species, hard to catch.
- No sexual dimorphism between males and females.
-High flying bats, endemic to the Sunda Shelf in southeast Asia, including Peninsular Malaysia, Borneo, western Indonesia and the Philippines (Kristofer et al., 2007), found in lowland, hill, and montane forest.
-On Borneo, it has been found to roost in hollow trees and caves (Csorba et al., 2008).
Cyt B reconstructs phylogeny and known relationships between species more accurately and gives better resolution for separating species with a lower false positive rate and higher positive predictive value than Cytochrome oxidase subunit 1 (CO1). Cyt B is isolated from the complete sequences for alignment.
According to IUCN (2008), D. spadiceus is near threatened (NT) species, which affected by deforestation due to expanding agriculture, logging, plantations and forest fires.
Shazali, N., Parvin Habeebur Rahman, S., Murni, R., Azhar, I., Macthur, E., Zacaery, K. (2016). Small mammals from Miri, nothesthen region of Sarawak, Malysian Borneo. Note on new locality records, 12(2), 1-2. doi:10.15560/12.2.1863
-One of the most distinct characteristics regarding of the Dayak fruit bats (Dyacopterus spadiceus) is the ability of lactation. This species is reasonably widespread in southeast Asia occurring from the Malay Peninsula, southern Thailand, to Indonesia and the species occurs in Borneo including Brunei and possibly Sumatra (A. Suyanto pers. comm. 2006) and the Philippines.
-Our main goals of this research is somehow to make a survey on display how much the population’s genetic diversity of Dayak fruit bats being diverged distinctly to each other in different western and eastern locations, the Bako National Park, Kubah National Park, Niah National Park, and Gunung Mulu National Park.
-To do so, our general methodology of sampling is by using the canopy and ground level mist nest and harp traps, the specimens collected for molecular analysis. Commonly, these bats were practiced foraging and being caught in the mist nest
Expecting to get a significance result by set up the research location’s which is far away within each other.
While due to the lack of survey on the Dayak Fruit bats will be a challenge for us to visual the range of population’s genetic of Dayak fruit bats’ genetic diversity being diverged.
-Dayak fruit bats is from the family of Pteropodidae, with the species name, Dyacopterus spadiceus. The motheod been used for sampling is the mist nets and harp traps where the mist net were erected at high potential flight pathway of bats while the harp were set crossing narrow pathways and along a river.
-For targeting high flying bats, high net were set up at sub-canopy level.For the molecular data analysis, running out Polymerase Chain Reaction (PCR) Amplification and Purification followed by Sequence Alignment and Phylogenetic Analysis after the extraction of DNA form the collected specimens were done.
-One of the distinct characteristics is that enlarged mammary glands that can produce small amounts of milk is possessing by the male Dayak fruit bats while the size of the teeth and large eye is suggested to be responsible for foraging and eating the large hard fruits(Francis, 2008; Hodgiskon, 2003; Kristofer, et al,. 2007).
-However, there is still a lot of gap or less research study related on genetic variation of Dayak fruit bats. For that, 4 location sites were targeted in this research study, whereby it is the Bako National Park, Kubah National Park, Niah National Park, and Gunung Mulu National Park.
-In others ways to said, we might expected the acceptance of the alternative hypothesis. While the molecular data analysis in our finding will enable us to move a step in the conservation of the nearly endangered Dayak fruit species.
-It is vital since there is still lack of research study regarding about the Dayak Fruit bats species.
-We are expected the significance of genetic variation of Dayak fruit bats species in between the regions of Eastern and Western of Sarawak
Bourassa, A. (2011). “Dyacopterus spadiceus” (On-line), Animal Diversity Web. Retrieved from http://animaldiversity.org/accounts/Dyacopterus_spadiceus/
Sampling areas are Kubah National Park, Bako National Park, Niah National Park, and Gunung Mulu National Park.Permit research on wildlife applied from Sarawak Forestry Corporation.
Four-bank harp traps and high pole 10-shelf mist nests (7.3m) used to trap bats, which reported as optimum effort in trapping chiropterans by Abdullah (2003) and Hall et al. (2004).
Harp traps positioned across trail, forest opening and small streams.
High nets set up at sub-canopy level.
- DNA extraction conducted using Qiagen DNA Blood and Tissue kit.
The sequences obtained were edited with the program Chromas Pro v. 1.5 (McCarthy, 1996) and were aligned with the program Clustal X v. 2.1 (Thompson, Gibson, Plewniak, Jeanmougin, & Higgins, 1997).
- PCR amplification was done using Cyt B universal primer Cytb 28f (5’ CGAACGTTGATATGAAAAACCATCGTTG3’) and Cytb 34r (5’ AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA3’)
- 2–10μl of DNA extract, 0.2μM of each primer, 2.5–4 mM of MgCl2, 0.2 mM each of 4 dNTPs, 1 unit of Taq DNA polymerase (QIAgen, Inc., Switzerland) with appropriate buffer and ddH2O.
Thermal profiles of amplifications included 3 min initial denaturation at 94°C, followed by 39 cycles at 94°C (45 s), 45–53°C (45 s) and 72°C (1.5 min), with a final extension at 72°C (5 min).
The genetic diversity parameters by species were obtained with the software DnaSP v. 5 (Librado & Rozas, 2009), based on the Kimura two-parameter substitution model (Kimura, 1980).
The Tajima index (D) was estimated for each species (Tajima, 1989) to identify some of the demographic evolutionary processes associated with genetic diversity
Abdullah, M. T. (2003). Biogeography and variation of Cynopterus brachyotis in Southeast Asia. PhD thesis, University of Queensland, St Lucia.
Hall, L. S., Grigg, G. G., Moritz, C., Ketol, B., Sait, I., Marni, W., & Abdullah, M. T. (2004). Biogeography of fruit bats in Southeast Asia. Sarawak Museum Journal, 60, 191-284.
McCarthy, C. (1996). Chromas (Version 1.5). Queensland, Australia: School of Health Science, Griffith University.
Librado, P., Rozas, J. (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics applications note, 25, 1451–1452.
Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120.
Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., & Higgins, D. G. (1997). The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25, 4876–4882.
