Please enable JavaScript.

Coggle requires JavaScript to display documents.

Genetic variation of Dayak fruit bats (Dyacopterus spadiceus) between…

- - - - Sampling areas are Kubah National Park, Bako National Park, Niah National Park, and Gunung Mulu National Park.
        
        Permit research on wildlife applied from Sarawak Forestry Corporation.
        
        Four-bank harp traps and high pole 10-shelf mist nests (7.3m) used to trap bats, which reported as optimum effort in trapping chiropterans by Abdullah (2003) and Hall et al. (2004).
        
        Harp traps positioned across trail, forest opening and small streams.
        
        High nets set up at sub-canopy level.
    - - DNA extraction conducted using Qiagen DNA Blood and Tissue kit.
      - PCR amplification was done using Cyt B universal primer Cytb 28f (5’ CGAACGTTGATATGAAAAACCATCGTTG3’) and Cytb 34r (5’ AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA3’)
      - 2–10μl of DNA extract, 0.2μM of each primer, 2.5–4 mM of MgCl2, 0.2 mM each of 4 dNTPs, 1 unit of Taq DNA polymerase (QIAgen, Inc., Switzerland) with appropriate buffer and ddH2O.
        Thermal profiles of amplifications included 3 min initial denaturation at 94°C, followed by 39 cycles at 94°C (45 s), 45–53°C (45 s) and 72°C (1.5 min), with a final extension at 72°C (5 min).
    - - The sequences obtained were edited with the program Chromas Pro v. 1.5 (McCarthy, 1996) and were aligned with the program Clustal X v. 2.1 (Thompson, Gibson, Plewniak, Jeanmougin, & Higgins, 1997).
      - The genetic diversity parameters by species were obtained with the software DnaSP v. 5 (Librado & Rozas, 2009), based on the Kimura two-parameter substitution model (Kimura, 1980).
      - The Tajima index (D) was estimated for each species (Tajima, 1989) to identify some of the demographic evolutionary processes associated with genetic diversity